UNITED STATES
SECURITIES AND EXCHANGE COMMISSION
Washington, D.C. 20549
___________________________________
FORM 8-K
___________________________________
CURRENT REPORT
Pursuant to Section 13 or 15(d)
of the Securities Exchange Act of 1934
Date of Report (Date of earliest event reported)
___________________________________
(Exact name of registrant as specified in its charter)
___________________________________
(State or other jurisdiction of incorporation) | (Commission File Number) | (I.R.S. Employer Identification No.) | ||||||
(Address of principal executive offices) | (Zip Code) | |||||||
( | ||||||||
(Registrant's telephone number, including area code) | ||||||||
___________________________________
Check the appropriate box below if the Form 8-K filing is intended to simultaneously satisfy the filing obligation of the registrant under any of the following provisions:
Written communications pursuant to Rule 425 under the Securities Act (17 CFR 230.425) | |||||
Soliciting material pursuant to Rule 14a-12 under the Exchange Act (17 CFR 240.14a-12) | |||||
Pre-commencement communications pursuant to Rule 14d-2(b) under the Exchange Act (17 CFR 240.14d-2(b)) | |||||
Pre-commencement communications pursuant to Rule 13e-4(c) under the Exchange Act (17 CFR 240.13e-4(c)) | |||||
Securities registered pursuant to Section 12(b) of the Act: | ||||||||||||||
Title of each class | Trading Symbol(s) | Name of each exchange on which registered | ||||||||||||
Indicate by check mark whether the registrant is an emerging growth company as defined in Rule 405 of the Securities Act of 1933 (§230.405 of this chapter) or Rule12b-2 of the Securities Exchange Act of 1934 (§250.12b-2 of this chapter).
Emerging growth company ☒
If an emerging growth company, indicate by check mark if the registrant has elected not to use the extended transition period for complying with any new or revised financial accounting standards provided pursuant to Section 13(a) of the Exchange Act. ☐
Item 2.02 Results of Operations and Financial Condition.
On August 7, 2023, Prime Medicine, Inc. (the “Company”) issued a press release announcing its financial results and business highlights for the quarter ended June 30, 2023. A copy of the press release is furnished as Exhibit 99.1 to this Current Report on Form 8-K.
Item 7.01 Regulation FD Disclosure.
A copy of the Company’s August 2023 corporate presentation is furnished as Exhibit 99.2 to this Current Report on Form 8-K, which is incorporated herein by reference.
The information contained in Item 2.02 and Item 7.01 of this Current Report on Form 8-K, including Exhibit 99.1 and Exhibit 99.2 attached hereto, is intended to be furnished and shall not be deemed “filed” for purposes of Section 18 of the Securities Exchange Act of 1934 (the “Exchange Act”) or otherwise subject to the liabilities of that section, nor shall it be deemed incorporated by reference in any filing under the Securities Act of 1933 or the Exchange Act, except as expressly set forth by specific reference in such a filing.
Item 9.01 Financial Statements and Exhibits.
(d) Exhibits
| Exhibit Number | Description | |||||||
| 99.1 | ||||||||
| 99.2 | ||||||||
104 | Cover Page Interactive Data File (embedded within the Inline XBRL document) | |||||||
SIGNATURE
Pursuant to the requirements of the Securities Exchange Act of 1934, the registrant has duly caused this report to be signed on its behalf by the undersigned hereunto duly authorized.
Date: August 7, 2023
By: | /s/ Keith Gottesdiener | ||||
Name: | Keith Gottesdiener, M.D. | ||||
Title: | President and Chief Executive Officer | ||||
Prime Medicine Reports Second Quarter 2023 Financial Results and Provides Business Updates
-- Presented new preclinical data demonstrating ability of Prime Editing to correct causative mutation of CGD and highlighting ability of PASSIGE™ platform to multiplex edit CAR-T cells at ASGCT Annual Meeting --
-- Entered strategic collaboration with Cimeio Therapeutics; multiplexing Cimeio’s shielded variants with therapeutic edits may meaningfully expand reach of Prime Editing --
-- Cash, cash equivalents, investments and restricted cash balance of $221.1 million as of June 30, 2023 --
Cambridge, Mass., August 7, 2023 – Prime Medicine, Inc. (Nasdaq: PRME), a biotechnology company committed to delivering a new class of differentiated one-time curative genetic therapies, today reported financial results and provided business updates for the second quarter ended June 30, 2023.
“In recent months, we continued to advance our diversified portfolio of Prime Editing programs while also executing against a strategic partnering strategy aimed at further expanding the broad therapeutic potential of Prime Editing,” said Keith Gottesdiener, M.D., President and Chief Executive Officer of Prime Medicine. “PM359, our product candidate for the treatment of CGD, is progressing well, and at the ASGCT Annual Meeting in May, we presented new preclinical data demonstrating its ability to reproducibly correct the CGD disease-causing mutation in CD34+ cells ex vivo with no detectable off-target editing. These findings further support our belief in the potential of this program to change the trajectory of this recurrent debilitating condition, and we look forward to sharing additional in vitro and in vivo data on this program and others later this year.”
Dr. Gottesdiener continued, “Also in the second quarter, we entered into a research collaboration with Cimeio Therapeutics, gaining access to Cimeio’s powerful CD117 immunotherapy technology for genetic diseases. We are pleased to be working together to evaluate combining Prime Editing enabled protective shielding with multiplexed therapeutic edits to potentially reduce the toxicity and increase the efficiency of existing HSC transplant regimens. These combined technologies may enable us to more gently and effectively treat a wider range of genetic diseases than currently possible, and future applications may include selection of in vivo edited HSCs, which could allow for the treatment of genetic diseases without transplantation. This partnership reflects the tremendous breadth of our Prime Editing technology, as well as our commitment to leveraging its versatility, precision and efficiency to improve the care and treatment of patients worldwide.”
Recent Business Updates
Pipeline
•Prime Medicine continued to advance its strategic pipeline of eighteen programs and remained on track to initiate investigational new drug (IND)-enabling studies of PM359, its development candidate for chronic granulomatous disease (CGD), in 2023.
•In May 2023, Prime Medicine presented new preclinical data at the American Society of Gene and Cell Therapy (ASGCT) 26th Annual Meeting. These data further demonstrated the potential for Prime Editing to correct the causative mutation of CGD and showcased the potential application of the Prime Assisted Site-Specific Integrase Gene Editing (PASSIGE™) platform to generate multiplex-edited CAR-T cells for the treatment of certain cancers and immune diseases. Read the full data here.
Corporate
•In June 2023, Prime Medicine announced a research collaboration with Cimeio Therapeutics to develop Prime Edited Shielded Cell and Immunotherapy Pairs™ (SCIP) for genetic diseases, acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS). The goal of the research is to reduce the toxicity of
conditioning regimens and introduce new therapeutic options to meaningfully expand the utility of hematopoietic stem cell (HSC) transplant and enable the in vivo selection of edited HSCs to potentially remove the need for transplantation entirely. Under the terms of the agreement, Prime Medicine will develop a Prime Editor for Cimeio’s CD117 shielding variant that will then be evaluated by both companies; if the research collaboration is successful, the companies will grant exclusive license options to each other for their technologies. If the companies exercise their exclusive license options, they will each be eligible to receive economics on net sales of licensed products.
Anticipated Upcoming Milestones
Prime Medicine expects the following activities and next steps to drive the Prime Editing platform forward:
Pipeline
•Initiate investigational new drug (IND)-enabling studies for PM359 in CGD in 2023.
•Expand preclinical proof-of-concept in vivo data, with plans to share data from in vivo rodent studies and large animal studies from several programs in the second half of 2023.
•Share in vitro preclinical data in additional liver, eye and neuromuscular programs.
•Complete first IND filing as early as 2024 and additional IND filings anticipated in 2025.
Platform
•Continue to develop and optimize non-viral and viral delivery systems and share additional proof-of-concept data from in vivo rodent and large animal studies in the second half of 2023.
•Further demonstrate superior off-target profiles for Prime Editing programs.
•Expand Prime Editing using proprietary recombinase technologies for new and existing programs.
•Maximize Prime Editing’s broad therapeutic potential and create value through strategic business development that extends the reach and impact of Prime Editing to areas beyond Prime Medicine’s current areas of focus.
Second Quarter 2023 Financial Results:
•R&D Expenses: Research and development (R&D) expenses were $34.6 million for the three months ended June 30, 2023, as compared to $18.9 million for the three months ended June 30, 2022. This increase was primarily due to increases in lab supplies, personnel, and facilities costs as the company continues to expand and build out its R&D activities and function.
•G&A Expenses: General and administrative (G&A) expenses were $10.7 million for the three months ended June 30, 2023, as compared to $7.4 million for the three months ended June 30, 2022. This increase was primarily due to an increase in professional and consultant costs and personnel costs primarily attributable to the build-out of the company’s G&A team to support our R&D function.
•Net Loss: Net loss was $42.4 million for the three months ended June 30, 2023, as compared to $29.3 million for the three months ended June 30, 2022.
•Cash Position: As of June 30, 2023, cash, cash equivalents, investments and restricted cash were $221.1 million, as compared to $263.0 million as of March 31, 2023.
Financial Guidance
Based on its current operating plans, Prime Medicine expects that its cash, cash equivalents and investments as of June 30, 2023, will be sufficient to fund its anticipated operating expenses and capital expenditure requirements into 2025.
About Prime Medicine
Prime Medicine is a leading biotechnology company dedicated to creating and delivering the next generation of gene editing therapies to patients. The Company is leveraging its proprietary Prime Editing platform, a versatile, precise and efficient gene editing technology, to develop a new class of differentiated, one-time, potentially curative genetic therapies. Designed to make only the right edit at the right position within a gene while minimizing unwanted DNA modifications, Prime Editors have the potential to repair almost all types of genetic mutations and work in many different tissues, organs and cell types.
Prime Medicine is currently progressing a diversified portfolio of eighteen programs initially focused on genetic diseases with a fast, direct path to treating patients or with a high unmet need because they cannot be treated using other gene-editing approaches. Over time, the Company intends to maximize Prime Editing’s therapeutic potential and advance potentially curative therapeutic options to patients for a broad spectrum of diseases. For more information, please visit www.primemedicine.com.
Cautionary Note Regarding Forward Looking Statements
This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995, as amended, including, without limitation, implied and express statements about Prime Medicine’s beliefs and expectations regarding: the initiation, timing, progress, and results of its research and development programs, preclinical studies and future clinical trials, and the release of data related thereto, including the initiation of IND-enabling studies for PM359 in 2023, its ability to expand preclinical proof-of-concept in vivo data and plans to share data from several programs in the second half of 2023, the timing of its regulatory filings, including its anticipated initial IND application submission as early as 2024 with additional filings anticipated in 2025, and plans to share preclinical in vitro data in additional programs; the potential of PM359 to reproducibly correct the causative mutation of CGD, and the capacity of its PASSIGE technology to edit CAR-T cells for the treatment of certain cancers and immune diseases; its development and optimization of various non-viral and viral delivery systems; its ability to demonstrate superior off-target profiles for Prime Editing programs; its expansion of Prime Editing using proprietary recombinase and/or retrotransposon and other proprietary technologies; the expansion of Prime Editing’s therapeutic potential and the creation of value through strategic business development to extend the reach and impact of Prime Editing to areas beyond Prime Medicine’s current areas of focus; its expectations regarding the breadth of Prime Editing technology; the research collaboration to combine Prime Medicine and Cimeio’s respective technologies, including Prime Medicine’s Prime Editing platform and Cimeio’s SCIP platform, and the goals of such collaboration; the potential benefits of such collaboration and technology thereunder, including the ability to cure various diseases and replace existing treatments such as transplantation; and the exercise of the exclusive options and payment of economics; the implementation of its strategic plans for its business, programs, and technology; and its estimates of expenses, capital requirements, and needs for additional financing and its expectations regarding the ability to fund its anticipated operating expenses and capital expenditure requirements into 2025. The words “may,” “might,” “will,” “could,” “would,” “should,” “expect,” “plan,” “anticipate,” “intend,” “believe,” “expect,” “estimate,” “seek,” “predict,” “future,” “project,” “potential,” “continue,” “target” and similar words or expressions are intended to identify forward-looking statements, although not all forward-looking statements contain these identifying words.
Any forward-looking statements in this press release are based on management’s current expectations and beliefs and are subject to a number of risks, uncertainties and important factors that may cause actual events or results to differ materially from those expressed or implied by any forward-looking statements contained in this press release, including, without limitation, risks associated with: uncertainties related to the authorization, initiation, and conduct of preclinical and IND-enabling studies and other development requirements for potential product candidates, including uncertainties related to opening INDs and obtaining regulatory approvals; risks related to the development and optimization of new technologies, the results of preclinical studies, or clinical studies not being predictive of future results in connection with future studies; the scope of protection Prime Medicine is able to establish and maintain for intellectual property rights covering its Prime Editing technology; Prime Medicine’s ability to identify and enter into future license agreements and collaborations; and general economic, industry and market conditions, including rising interest rates, inflation, and adverse developments affecting the financial
services industry. These and other risks and uncertainties are described in greater detail in the section entitled “Risk Factors” in Prime Medicine’s most recent Quarterly Report on Form 10-Q, as well as any subsequent filings with the Securities and Exchange Commission. In addition, any forward-looking statements represent Prime Medicine’s views only as of today and should not be relied upon as representing its views as of any subsequent date. Prime Medicine explicitly disclaims any obligation to update any forward-looking statements subject to any obligations under applicable law. No representations or warranties (expressed or implied) are made about the accuracy of any such forward-looking statements.
Investor Contact
Hannah Deresiewicz
Stern Investor Relations, Inc.
212-362-1200
hannah.deresiewicz@sternir.com
Media Contact
Dan Budwick, 1AB
dan@1ABmedia.com
Condensed Consolidated Balance Sheet Data
(unaudited)
| (in thousands) | June 30, 2023 | December 31, 2022 | ||||||||||||
| Cash, cash equivalents, and investments | $ | 207,618 | $ | 293,921 | ||||||||||
| Total assets | 280,865 | 360,314 | ||||||||||||
| Total liabilities | 40,763 | 44,044 | ||||||||||||
| Total stockholders’ equity | 240,102 | 316,270 | ||||||||||||
Condensed Consolidated Statement of Operations
(unaudited)
| Three Months Ended June 30, | ||||||||||||||
| (in thousands, except share and per share amounts) | 2023 | 2022 | ||||||||||||
Operating expenses: | ||||||||||||||
Research and development | $ | 34,599 | $ | 18,940 | ||||||||||
General and administrative | 10,658 | 7,365 | ||||||||||||
Total operating expenses | 45,257 | 26,305 | ||||||||||||
Loss from operations | (45,257) | (26,305) | ||||||||||||
Other income (expense): | ||||||||||||||
| Change in fair value of short-term investment — related party | 263 | (3,723) | ||||||||||||
Other income, net | 2,640 | 238 | ||||||||||||
Total other income (expense), net | 2,903 | (3,485) | ||||||||||||
Net loss before income taxes | (42,354) | (29,790) | ||||||||||||
(Provision for) benefit from income taxes | (31) | 442 | ||||||||||||
Net loss | $ | (42,385) | $ | (29,348) | ||||||||||
Cumulative dividend on preferred stock | — | (6,293) | ||||||||||||
Net loss attributable to common stockholders | $ | (42,385) | $ | (35,641) | ||||||||||
Net loss per share attributable to common stockholders, basic and diluted | $ | (0.47) | $ | (1.76) | ||||||||||
Weighted-average common shares outstanding, basic and diluted | 90,467,298 | 20,227,343 | ||||||||||||
1 Prime Medicine August 2023
2 This presentation contains forward-looking statements of Prime Medicine, Inc. (“Prime”, “we” or “our”) within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements contain information about our current and future prospects and our operations and financial results, which are based on currently available information. All statements other than statements of historical facts contained in this presentation, including statements regarding our strategy, future financial condition, future operations, projected costs, prospects, plans, objectives of management and expected market growth, are forward-looking statements. In some cases, you can identify forward-looking statements by terminology such as ‘‘aim,’’ ‘‘anticipate,’’ ‘‘assume,’’ ‘‘believe,’’ ‘‘contemplate,’’ ‘‘continue,’’ ‘‘could,’’ ‘‘design,’’ ‘‘due,’’ ‘‘estimate,’’ ‘‘expect,’’ ‘‘goal,’’ ‘‘intend,’’ ‘‘may,’’ ‘‘objective,’’ “opportunity,” ‘‘plan,’’ ‘‘predict,’’ ‘‘positioned,’’ ‘‘potential,’’ ‘‘seek,’’ ‘‘should,’’ ‘‘target,’’ ‘‘will,’’ ‘‘would’’ and other similar expressions that are predictions of or indicate future events and future trends, or the negative of these terms or other comparable terminology. These forward-looking statements include, but are not limited to, express or implied statements about Prime’s beliefs and expectations regarding: the initiation, timing, progress and results of our research and development programs, preclinical studies and future clinical trials, including the initiation of investigational new drug-enabling studies for chronic granulomatous disease (CGD) and our programs for Friedreich’s Ataxia and Cystic Fibrosis; the capacity of our PASSIGE technology to be used in cell therapy; our ability to demonstrate, and the timing of, preclinical proof-of-concept in vivo for multiple programs; our ability to pursue our strategic indication categories: immediate target indications, repeat expansion disorder indications and other differentiation target indications; the timing of our regulatory filings, including our investigational new drug applications submissions, including our anticipated initial IND submission as early as 2024 with additional filings anticipated in 2025; our ability to demonstrate superior off-target profiles for Prime Editing programs; our development and optimization of various non-viral and viral delivery systems; our expansion of Prime Editing using proprietary recombinase and/or retrotransposon and other proprietary technologies; the scope of protection we are able to establish and maintain for intellectual property rights covering our Prime Editing technology; the research collaboration to combine our and Cimeio’s respective technologies, including our Prime Editing platform and Cimeio’s SCIP platform, and the goals of such collaboration, the potential benefits of such collaboration and technology thereunder, including the ability to cure various diseases and replace existing treatments such as transplantation, and the exercise of the exclusive options and payment of economics; the implementation of our strategic plans for our business, programs and technology, including our ability to identify and enter into future license agreements and collaborations; and our estimates of our expenses, capital requirements, and needs for additional financing as well as our cash runway into 2025. Actual results or events could differ materially from the plans, intentions and expectations disclosed in the forward-looking statements we make due to a number of risks and uncertainties. These and other risks, uncertainties and important factors are described in the section entitled "Risk Factors" in our most recent Quarterly Report on Form 10-Q, as well as any subsequent filings with the Securities and Exchange Commission. Any forward-looking statements represent our views only as of the date of this presentation and we undertake no obligation to update or revise any forward-looking statements, whether as a result of new information, the occurrence of certain events or otherwise. We may not actually achieve the plans, intentions or expectations disclosed in our forward-looking statements, and you should not place undue reliance on our forward-looking statements. No representations or warranties (expressed or implied) are made about the accuracy of any such forward-looking statements. Certain information contained in this presentation relates to or is based on studies, publications, surveys and other data obtained from third-party sources and our own internal estimates and research. While we believe these third-party studies, publications, surveys and other data to be reliable as of the date of this presentation, we have not independently verified, and make no representation as to the adequacy, fairness, accuracy or completeness of, any information obtained from third-party sources. In addition, no independent source has evaluated the reasonableness or accuracy of our internal estimates or research and no reliance should be made on any information or statements made in this presentation relating to or based on such internal estimates and research. Forward-Looking Statements
3 Prime Medicine brings together the right people and the right technology at the right time with the aim to deliver the promise of one-time, curative genetic therapies to address the widest spectrum of diseases. 30 years after the first patient was treated with gene therapy, gene editing is only just beginning to demonstrate clinical benefit. Now is the moment for a revolution.
5 Delivering the full promise of gene editing requires an extremely powerful technology Prime Editing (PE) stands out as a best-in-class genetic medicine approach Versatility: only gene editing technology with the capability to edit, correct, insert, and delete Performs and corrects insertions, deletions, and all twelve types of single base pair corrections Precisely targets to insert or delete kilobase-sized DNA Easily programmable to a unique target location and for a broad set of edits Restores gene function for multiple mutations with a single product (i.e., “hotspots”) Precision: May be much safer with minimal, or no, off-target editing Does not create double stranded breaks: high specificity with low indels rate at targeted editing site Does not create double stranded breaks: minimal or no off-target activity Limited potential for “bystander editing” at target site Efficiency: Durable and high-efficiency editing demonstrated across Prime Medicine portfolio Permanent edits that are passed along to daughter cells Corrects genes in situ, maintaining native gene control Single-dose, potentially curative correction to wild-type sequence Breadth: Able to address ~90% of disease-causing mutations in multiple tissue types and cells Corrects mutations in dividing and non-dividing human cells 100’s of potential indications already available in Prime Editing’s toolbox
6 Prime Medicine is well-positioned to maximize Prime Editing’s broad therapeutic potential In ~2.5 years since company inception: Built and advanced a strategic portfolio Identified and progressed initial pipeline of 18 programs • Focusing on indications with the fastest, most direct path to demonstrating technological success, as well as diseases that cannot be treated using other gene-editing approaches • In vivo studies in progress across portfolio; multiple programs advancing toward development candidates, with first IND filing potentially as early as 2024 Demonstrated Prime Editing capabilities: established preclinical proof-of-concept and safety • In vivo long-term engraftment of Prime Edited hematopoietic stem cell therapy for Chronic Granulomatous Disease • Efficient removal of pathological repeats in Friedreich’s Ataxia, a Repeat Expansion Disease, with phenotypic correction in patient organoids • Efficient editing with phenotypic correction of cystic fibrosis patient organoids Advanced CMC and delivery capabilities • Efficient in vivo Prime Editing in rodent liver and central nervous system Optimized and expanded Prime Editing platform, capabilities and IP • One-step non-viral precise insertion of whole genes into the genome in primary human cells using PASSIGE technology • Industrialized and automated Prime Editor screening capabilities • Advanced and substantially improved Prime Editing • Developed strong Intellectual Property position Established strong corporate position Led by world-class, diverse team of researchers and drug developers; grew company to ~200 employees Raised ~$315M in Series A/B, and ~$200M in IPO (Oct ‘22), from a blue-chip group of investors Leveraging close relationship with founders David Liu and Andrew Anzalone to bring new innovation rapidly into Prime Medicine Aim to create additional value and extend reach through BD and partnering in 2023
7 Our current portfolio of 18 programs leverages the versatility and breadth of Prime Editing Initially focused on our first two strategic indication categories in diseases where Prime Editing could offer compelling advantages over current standard-of-care and novel therapeutic modalities in development To be discussed in detail today STRATEGIC CATEGORY TARGET TISSUE INDICATION DELIVERY DISCOVERY LEAD OPTIMIZATION IND-ENABLING Phase 1/2 IMMEDIATE BLOOD Chronic Granulomatous Disease ex vivo Fanconi Anemia ex vivo LIVER Wilson’s Disease LNP Glycogen Storage Disease 1b LNP EYE Retinitis Pigmentosa/Rhodopsin AAV Retinitis Pigmentosa/Usher Syndrome AAV EAR Usher Syndrome Type 3 AAV Non-Syndromic Hearing Loss – GJB2 AAV DIFFERENTIATION: REPEAT EXPANSION DISEASES NEURO- MUSCULAR Friedreich’s Ataxia AAV Myotonic Dystrophy Type 1 viral/non-viral Amyotrophic Lateral Sclerosis viral/non-viral Oculopharyngeal Muscular Dystrophy LNP Fragile X Syndrome viral/non-viral Huntington’s Disease TBD EYE Fuchs’ Endothelial Corneal Dystrophy viral/non-viral DIFFERENTIATION: OTHER MUSCLE Duchenne Muscular Dystrophy AAV LUNG Cystic Fibrosis LNP PARTNERED PROGRAMS BLOOD Sickle Cell Disease ex vivo *Pipeline reflects the current development stage and will be updated quarterly
81234 clones analyzed; 2Normalized to healthy donor controls; 3Myeloid cells produced from CD34+ cells were analyzed by flow cytometry for detection of myeloid markers including CD13 (percentage of cells expressing CD13 is depicted); 4 Oxidization of dihydrorhodamine (DHR) to fluorescent rhodamine by functional myeloid cells. Performed in collaboration with Dr. Suk See DeRavin (National Institute of Health (NIH) – National Institute of Allergy and Infectious Diseases (NIAID) and Dr. Harry Malech (NIH - NIAID). Data presented at ASGCT 26th Annual Meeting, May 2023. Prime Edited CGD patient CD34+ cells generate myeloid cells that produce p47phox protein and NADPH oxidase activity Myeloid progeny of Prime-Edited CD34+ cells from patient donor show functional p47phox expression Prime Editing results in ~80% of the p47phox levels in healthy donor myeloid cells, and restores oxidase activity in myeloid cells Function recoveredp47phox expression restoredGene corrected PE restores NADPH oxidase activity in myeloid cell progeny4 p47phox expression2 restored in CGD myeloid cells3 Post-editing patient CD34+ cell clonal analysis1 Chronic Granulomatous Disease (CGD)
9 Maintenance of >92% corrected long-term HSCs following 16-week engraftment Successful Prime Editing in long-term HSC population: in vivo engraftment of Prime Edited CD34+ Cells NBSGW: NOD.Cg-KitW41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ highly immunodeficient mice that support human CD34+ cell engraftment without irradiation. HSC: hematopoietic stem cell. PE: Prime Edited. Naive CD34+Prime Editor Cryopreserve/Thaw 0hr 24hr Editing performed by electroporation Conclusions High efficiency, very precise editing of HSCs High-level, long-term engraftment resulting in healthy Prime Edited long-term HSCs Restores key myeloid function to fight infection Generate all lineages without skewing Mice are healthy at 16 weeks, no toxicity Recapitulates the expected clinical study design NBSGW miceEdited CD34+ 0 weeks 16 weeks Long-term engrafted CD34+ HSCs carry precise correction of NCF1 No difference in engraftment for PE Edited HSCs vs controls Minimum threshold for patient benefit CGD - Ex-Vivo HSC
10 Long-term study with cells from single donor (Donor 2) shows ~90% LT-HSC correction (similar to Donor 1 results on previous slide)1 Successful Prime Editing in long-term HSC population: Prime Editing is highly reproducible 1Long-term engraftment is 16-weeks after CD34+ cell infusion. 2Data for donors 1,3,4 is highly similar 3No significant difference in engraftment between Mock and PE groups. Statistical analyses by two-way ANOVA. Data presented at ASGCT 26th Annual Meeting, May 2023. CGD - Ex-Vivo HSC ex vivo >90% cells corrected (Donors 2-4) in vivo analysis shows: (Donor 2 only)2 >95% human cell engraftment3 >90% editing in LT-HSCs Similar editing efficiency, engraftment and preservation of long-term HSCs observed across all four donors
11 No significant difference between mock and Prime Edited LT-HSC in hematopoietic reconstitution Successful Prime Editing: 16-week engrafted Prime Edited long-term HSCs support multilineage blood production, biodistribution in vivo No significant difference between Mock and PE groups. Statistical analyses by two-way ANOVA. Data presented at ASGCT 26th Annual Meeting, May 2023. CGD- Ex-Vivo HSC Mock Prime Edited Spleen Peripheral bloodBone marrow
12 High efficiency Prime Editing removes the GAA pathological repeats and hyper-methylation at the Frataxin (FXN) gene in Friedreich’s Ataxia patient cells Successful Prime Editing removal of pathogenic repeats: Friedreich’s ataxia Demethylation by Prime Editing restores mRNA transcription of FXN Hyper-methylation prevents mRNA transcription of FXN Promoter Intron 1 Repeats Exon 1 X Prime Editing Promoter Intron 1 Prime Edited Exon 1 FRDA iPSCs* % p re ci se c or re ct io n High efficiency, very precise editing of patient cells without double strand breaks Restores normal methylation of FXN gene M ethylation (% ) Promoter Intron 1 Healthy Patient Patient Prime Edited Removal of Hyper-Methylation1 Repeat Expansion Diseases Many repeat expansion diseases exhibit hyper-methylation as a key feature of the underlying pathogenesis FXN: frataxin gene: FRDA: Friedreich’s ataxia; iPSCs: induced pluripotent stem cells. 1 Methylation quantified by bisulfite sequencing
13 FXN: Frataxin; FRDA: Friedreich's Ataxia; iDRG: iPSC-derived dorsal root ganglia. DAPI: nuclear staining; βIII-TUB: axonal projection staining High efficiency Prime Editing restores FXN protein expression and sensory neuron function in Friedreich’s Ataxia patients’ dorsal root ganglia Successful Prime Editing removal of pathogenic repeats FRDA patient iPSCs βIII-TUB DAPI Healthy Donor FRDA Patient FRDA Patient Prime-Edited Restoration of axonal projections after Prime Editing Frataxin (mature) GAPDH Control Restoration of Frataxin protein expression after Prime Editing 12 kDa 40 kDa Repeat Expansion Diseases
14 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients with G542X mutation 1 2 3 4 5 Prime Editing of patient intestinal organoids restores swelling and CFTR function Intestinal organoids swelling assay for CFTR function Healthy control G542X with mock treatment G542X with Prime Editing correction G542X with TRIKAFTA® treatment Optimization results in high efficiency Prime Editors that precisely correct G542X mutation Prime Editing Optimizations % p re ci se c or re ct io n Unmet need in CF
15 Safety: Prime’s comprehensive suite of assays for off- target discovery* On-target Off-targetPE2 PE2 genome GGCCCAGACTGAGCACGTGA GGCCCAG-CTGAGCTCGTGA Targeted Sequencing (>1000x) potential off-target editing sites Identified Off-targets Genome wide Nick Detection Assay** Genome wide DSB detection Targeted Nick Detection Assay** Local off-targets Chromosome scale or structural off-targets Translocations Large Deletions cDNA synthesis mRNAseq PEG integration Chromosomal Integrity Assays Identified Off-targets Imaging Sequencing based Whole Genome Sequencing Vector Integration Analysis Reverse Trans. Assay Off-Target *Preliminary plans pending discussions with regulatory agencies; **Proprietary assay developed by Prime
16 Safety: Preliminary off-target analyses demonstrate minimal or no off-target editing Data expands the demonstration of no off-target editing detected across multiple prime edited cell types On-target (NCF1) Targeted Sequencing Genome wide and targeted detection of potential off- targets potential off- target editing sites Identified off-targets 0.5% threshold On-target (ATP7B) CGD Program: CD34+ Cells1 Wilsons Disease Program: Hepatocytes2 Off-Target 1Analysis of edited CD34+ cells from CGD program: Targeted Analysis of 550 potential off-target sites of off-target editing. 2Analysis of edited iHEP (iPSG hepatocyte) cells from the Wilsons Disease program: Targeted Analysis of 170 potential off-target sites. SNP: Single nucleotide polymorphisms
17 Safety: No large deletions or translocations detected in Prime Edited LT-HSCs Off-Target Data from analysis of total human material from mouse bone marrow harvested 16 weeks after engraftment dPCR: CD34+ population was sorted and expanded in colony forming media, individual colonies were picked and presence of the indicated chromosomal segments measured, N=number of colonies measured One-Sided PCR: total material was amplified using a one-sided pcr protocol to identify genomic sequence changes adjacent to the edit site. Positive control sample was generated by transfecting HEK293T with sgRNA against NCF1 and SpCAS9 mRNA. Data presented at ASGCT 26th Annual Meeting, May 2023. Translocation Positive Control: Cas9 nuclease edited cells No large deletions or translocations in bone marrow engrafted LT-HSC No large deletions in pre-infusion CD34+ cell clones One-sided PCR Chromosomal alterations assayDigital PCR Large Deletion Assay
18 LNP Delivery: Optimization of mRNA increases Prime Editing efficiency and leads to reduction of PCSK9 protein in serum Prime Editor LNP delivered systemically • Prime Editor mRNA • Prime Eeditor guide RNA Optimized mRNA increases Prime Editing in whole liver Day 0 Day 7 Optimized mRNA decreases PCSK9 protein in blood mRNA lot # LNP delivery to mice results in 42% PCSK9 Prime Editing and 92% serum protein reduction mRNA lot # LNP Delivery Prime Editor LNP delivered to the liver a precisely introduced stop codon in PCSK9 gene in mice
191Three weeks in neonatal mice via intra-cerebral infusion (ICV); 5 weeks in adult mice via local administration into cerebellum or cortex. 2Prime Editor cassette with neuron-specific promoter. All experiments shown are Proof of Concept delivery experiments using a control Prime Editor site. Prime Editing Delivery: CSF and Local Administration to CNS via dual AAV achieves high efficiency in mouse brain Dual AAV2 effectively delivers to ~ 95%, and precisely edits ~80%, of neurons in adult mice Prime Editor dual AAV • Prime Editor • Prime Eeditor dual guide RNA 0 weeks 3-5 weeks1 Neonatal mice – ICV infusion1 transduced cortex (left) and precisely edited cortical cells (right) Adult mice – local administration1 transduced neurons (left) and precisely edited neurons2 (right) % p re ci se c or re ct io n Prime EditedTransduced % o f ce lls t ra ns du ce d Isolate transduced cells Measure editing Transduced % o f ne ur on s tr an sd uc ed % p re ci se c or re ct io n in n eu ro ns Prime Edited Isolate transduced neurons Measure editing Dual AAV Delivery
20 Prime Medicine has rapidly advanced and substantially improved Prime Editing Engineered pegRNAs4 • Improved pegRNA stability • Up to 4-fold increase in editing Novel PE Proteins • 80+ active RT domains • RT domains up to 60% smaller • Up to 2-fold increase in editing pegRNA Enhancements • New classes of efficiency-increasing pegRNAs enhancements Seminal Prime Editing Publication1 • All base pair edits, insertions of 40+ bp, deletions of 80+ bp • Efficiencies ranging from ~10%-60% • Targeted introduction of recombinase site Dual Flap Prime Editing2 • Efficiencies ≥80% • Hotspot editing and larger insertions • Synergies with recombinase enzymes (>5-kb targeted DNA integration) PASSIGE System • Advanced PE+ recombinase approach • Targeted whole gene insertions with up to 60% efficiency Peer reviewed publications: 1 Anzalone, et al, Nature 2019. 2 Anzalone, et al, Nat. Biotechnol. 2021. 3 Chen, et al, Cell 2021. 4 Nelson, et al, Nat. Biotechnol. 2021. PE4, PE5, and PEmax3 • Up to 7-fold increase in editing • Up to 2-fold decrease in byproducts
21 Patent portfolio includes: • U.S. Patent 11,447,770, covering methods of using Prime Editors • U.S. Patent 11,643,652, covering composition of matter for Prime editor guide RNAs (PEgRNAs) • U.S. allowed application 17/751,599, covering Prime Editing systems that include PEgRNA, Prime Editor protein and, optionally, recombinase (expected to issue Q3 2023) Prime Medicine has filed for additional IP protection for technological advancements Prime Medicine holds foundational IP for Prime Editing Committed to securing broadest IP protection for platform technology, programs and advances
22 PASSIGETM: Applying Prime Editing to insert gene sized sequences precisely in the genome Prime Assisted Site-Specific Integrase Gene Editing Prime Editing Site-specific recombination DNA donor Recombinase enzyme Precise target location in genomic DNA Genomic DNA Programmed insertion of recombinase DNA target sequence Genomic DNA with recombinase target sequence (pink) Gene-sized DNA (purple) inserted at precise location in the genome Integration of DNA at precise location One step non-viral kilobase-size gene editing approach – without double stranded breaks PASSIGE
23 Model of Multiplex Edited CAR-T CAR: chimeric antigen receptor; TRAC: T-cell receptor alpha constant; PASSIGE: Prime-Assisted Site-Specific Integrase Gene Editing PASSIGE and multiplex Prime Editing approach for allogeneic off-the-shelf CAR-T cell product Supports potential for Prime Editing to be applied to develop a best-in-class allogeneic CAR-T cell product X X PASSIGE to integrate CAR at T cell receptor (TRAC) locus Make T cells tumor-specific T cell receptor KO prevents GvHD Components for all Edits delivered together without the use of viruses Multiplex with Prime Editing to KO B2M, remove MHC Class I Evade patient immune system Allows for repeat administration if needed
24PASSIGE: Prime-Assisted Site-Specific Integrase Gene Editing; n = 2 technical replicates ; Far right panel: n = 4 technical replicates; Two-way ANOVA with Bonferroni post-test *** P = 0.0002; **** P < 0.0001 Data presented at ASGCT 26th Annual Meeting, May 2023. PASSIGE: Efficient insertion of anti-CD19 CAR at the TRAC locus in human primary T cells Prime Editing to insert recombinase site Recombinase to integrate anti-CD19 CAR Anti-CD19-CAR Genetic cargo 3.5kb Targeted integration of the anti-CD19 CAR has been observed to provide potent tumor killing function in preclinical studies Tumor cell killing at 72 hoursInsertion of recombinase site - over 90% efficiency Integration of CAR at TRAC in 60% of T cells Control T cells PASSIGE T cells Prime Editor % V ia bl e C D 19 + Tu m or C el ls Effector : Target Cell RatioAnti-CD19 CAR % C D 3 lo ss PASSIGE PASSIGE one-step non-viral approach for precise introduction of genetic cargo into the genome TRAC locus ••• •••
25Data presented at ASGCT 26th Annual Meeting, May 2023. PASSIGE: Knockout of B2M can be achieved in 95% of Prime-Edited T cells and PASSIGE CAR-T cells reduce tumor burden in vivo Knockout with Prime Editing is efficient in T cells and can be done in multiplex PASSIGE Prime Editing technologies can be used to introduce multiple genomic modifications in cell therapies β2 microglobulin is knocked out by introducing a stop codon precisely in the B2M gene Anti-CD19 CAR-T cells generated with PASSIGE show reduced tumor burden in vivo Transplant tumor cells in NSG mice Treat mice with Control or PASSIGE CAR-T cells Measure tumor burden by bioluminescent
26PE = Prime Editing Business Development and Partnering: A major focus for 2023 We aim to maximize PE’s broad therapeutic potential and create value by: Independently developing and commercializing in appropriate disease areas (our pipeline) Entering strategic collaborations to extend the reach and impact of PE, provide funding, and create value in areas we may not enter ourselves in the near-term but may enter later Partnering and licensing to access enabling technologies, including delivery, manufacturing and technologies synergistic with Prime Medicine products 1 2 3 This strategy aims to fully exploit the richness of our potential to create programs and address indications, while focusing our internal resources on what we do best, ultimately accelerating our efforts to translate PE into new medicines for patients worldwide. Business Development
27 HSC = Hematopoietic Stem Cell; AML/MDS = Acute Myeloid Leukemia/Myelodysplastic Syndrome; SCIP = Shielded Cell and Immunotherapy Pairs Prime Medicine and Cimeio: Research collaboration to enable best-in-class HSC medicines Goal: Reduce toxicity of conditioning regimens and introduce new therapeutic options to expand utility of HSC transplant and in vivo genetic therapies Broad Opportunity HSCT market is large and growing, but conditioning toxicity is major bottleneck • HSC transplant is curative for many diseases, but utility is limited by need for myeloablative conditioning regimens • Less toxic regimen could expand addressable market by multiples of current size Combining Prime Editing with Cimeio’s SCIP platform may: • Improve safety and effectiveness of HSC transplant, significantly improving accessibility, eligibility and outcomes • Enable selection of in vivo edited HSCs, allowing for treatment of genetic diseases without transplant Strategic Rationale Developing Prime Editor for Cimeio’s CD117 shielding variant • CD117 is a cell-surface receptor that plays a critical role in survival, proliferation and differentiation of HSCs; blocking or ablating CD117 signaling results in death of the HSC • CD117 epitopes can be edited to ablate antibody binding while retaining receptor function. This enables clearance of wild type CD117 expressing cells, while protecting cells with the edited epitope • Prime Editing appears to be an effective way to edit Cimeio’s anti-CD117 binding epitopes Collaboration Details If successful, companies will grant exclusive license options to each other: • Prime will receive exclusive option to license SCIP technology for CD117-shielded HSC transplant, as well as in vivo editing of CD117-shielded HSCs for genetic diseases • Cimeio will receive exclusive option to license Prime Editing for CD117-shielded allogeneic HSC product for AML/MDS and, potentially, a second shielding protein for use in AML/MDS • If options are exercised, both companies are eligible to receive economics on net sales of licensed products
28 Prime can multiplex to combine shielding with therapeutic edits Patient HSCs Carrying Pathogenic Mutation Edited HSCs Carrying Corrected Gene and CD117 Shielding Edit Prime Editing to make a single amino acid substitution at epitope required for antibody binding Target of Shielding Edit Shielding Edit Prime Editing to make a precise genetic correction of a pathogenic mutation Edit #1 Genetic Correction Edit #2 Shielding Edit Multiplex Editing in Single Electroporation Step Electroporate* *Potential for in vivo transduction in future iterations
29 Currently • ~200 employees; approximately 85% across Research & Technical Development • Key leadership and staff across all departments of the organization in place • Built out core capabilities across the company, from IP strategy to automation and AI to RNA technologies • Established strong external relationships • 3 locations in Cambridge, MA and a chemistry facility in Watertown, MA, with buildout of 150,000 square feet permanent space in an additional Cambridge facility, target for move in 2024 • Successful IPO in Oct 2022, with >$500M raised to date Building the Company September 2019 $115M Series A October 2019 Prime Editing seminal Nature1 paper July 2020 Commenced Corporate Operations April 2021 $200M Series B 4 45 90 July 2020 July 2021 Dec 2021 July 2022 Critical Milestones Achieved Successful Growth of Talent Dec 184+ Oct 2022 ~$200M IPO
30 Summary of select ongoing activities and next steps for Prime Medicine Key upcoming events will continue to drive the Prime Medicine platform forward Pipeline Nominated first Development Candidate for Chronic Granulomatous Disease (CGD) in 1Q 2023. • Initiate investigational new drug (IND)-enabling studies in CGD in 2023. • Expand preclinical proof-of-concept in vivo, including sharing data from in vivo rodent studies and large animal studies in several programs in 2H 2023. • Share in vitro preclinical data in additional liver, eye and neuromuscular programs. • First IND filing expected as early as 2024 and additional IND filings anticipated in 2025. Platform • Continue to develop and optimize non-viral and viral delivery systems and share additional proof-of-concept data from in vivo rodent and large animal studies in 2H 2023. • Further demonstrate superior “off-target” profile for Prime Editing programs. • Extend Prime Editing using proprietary recombinase and/or retrotransposon technologies for new and existing programs. Strong cash position: Cash, cash equivalents and investments as of 3/31/2023 sufficient to fund anticipated operating expenses and capital expenditure requirements into 2025.
31 Backup
32 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients with G542X mutation 1 2 3 4 5 Prime Editing of patient intestinal organoids restores swelling and CFTR function Intestinal organoids swelling assay for CFTR function Healthy control G542X with mock treatment G542X with Prime Editing correction G542X with TRIKAFTA® treatment Optimization results in high efficiency Prime Editors that precisely correct G542X mutation Prime Editing Optimizations % p re ci se c or re ct io n Unmet need in CF
33 Van Mourik et al., 2019. Actual time course: 24 hours. TRIKAFTA® is a registered trademark of Vertex Pharmaceuticals, Incorporated. One-time, non-viral delivery to patient intestinal organoids restores CFTR function Unmet needs in Cystic Fibrosis: Potential to restore CFTR function in patients with G542X mutation 1 2 3 4 5 Prime Editing of patient intestinal organoids restores swelling and CFTR function Intestinal organoids swelling assay for CFTR function Healthy control G542X with mock treatment G542X with Prime Editing correction G542X with TRIKAFTA® treatment Optimization results in high efficiency Prime Editors that precisely correct G542X mutation Prime Editing Optimizations % p re ci se c or re ct io n Unmet need in CF